Page 264 - Avian Virology: Current Research and Future Trends

Chicken Infectious Anaemia Virus | 257

the CIA-1 strain. The use of 1-day-old chickens is currently only However, expression of ORF4 and the five ORFs on the nega-
justifiable if PCR or RT-PCR assays indicate the presence of CAV, tive strand could not be demonstrated. The nomenclature of
isolation of the virus is needed for experimental work, and inocu- the ORFs and VPs is confusing. Because the ORF’s are located
lation of cell lines or chick embryos fails. on the complimentary strand, Todd (2000) referred to the three
ORFs as C1 for VP1, C2 for VP2 and C3 for VP3. In this review,
Genome structure and organization I will use ORF1 for VP1, ORF2 for VP2, and ORF3 for VP3.
Gelderblom et al. (1989) and Todd et al. (1990), using slightly The ICTV recommends that the ORF1 sequences are used at
different approaches concluded that the genome of CAV consists the nt level for classification of Anelloviridae (Biagini, 2015). The
of covalently linked circular, single-stranded DNA. A major suggested cut-off for isolates is < 20% variation, while different
breakthrough was the sequencing of two strains of CAV Cux-1 species have between 20 to 55% variation in nt sequence. Since
and 26P4, by Noteborn et al. (1991) and Claessens et al. (1991), the first sequences were published in the early 1990s many more
respectively. The Cux-1 isolate consisted of 2319 nucleotides (nt), sequences have been added to the database. Thus far, all phyloge-
while 26P4 had 2298 nt. The promoter/enhancer region consists netic trees for CAV indicate that all isolates belong to the same
of four direct repeats (DR) of 21 nt (Fig. 9.7A) (Claessens et al., species based on the ICTV criteria for Anelloviridae (Fig. 9.2).
1991), while the Cux-1 sequenced by Noteborn et al. (1991) has This finding is in sharp contrast to the recently described human
five DRs. This may, however, reflect the cell culture passage level and chicken gyroviruses and 11 recognized genera of teno torque
because Meehan et al. (1992) found only four direct repeats in viruses (see ‘Classification’). The ORF1 nt sequences of CAV are
his Cux-1 isolate, which seems to be the more common situation. often divided in the following four clusters: I, II, IIIa, and IIIb (e.g.
The CIA-1 strain also has 4 DR (GenBank accession no. L14767) Ducatez et al., 2006; Kim et al., 2010; Olszewska-Tomczyk et al.,
(Renshaw et al., 1996). Most strains have three partially overlap- 2016). Eltahir et al. (2011b) recognized four clusters (A–D) with
ping major open reading frames (ORF) coding for peptides of three subgroups in cluster A and two in group D. Intersubtype
51.6 (VP1), 24.0 (VP2) and 13.6 (VP3) kDa (Noteborn et al., recombinants have been reported by two groups with breakpoints
1991). An exception is the CAA82-2 isolate which has a 4th ORF occurring in VP1 (He et al., 2007; Eltahir et al., 2011a) potentially
(ORF4) on the positive strand with a start codon 101 nt down- adding to genetic diversity. The practical value of the division in
stream of the 51.6 peptide (Kato et al., 1995). These researchers different clusters and the possibility of recombinants is not clear.
also identified five putative small ORFs on the negative strand. Ducatez et al. (2008) stated that the nt or amino acid sequence

Figure 9.7 (A) Schematic diagram of the CAV promoter region with the areas used for the short and long promoter
expression vectors indicated by the bars under the diagram. The CAV promoter 21-bp direct repeat sequences are
TGTACAGGGGGGTACGTCACCCGTACAGGGGGGTACGTCACA, with the ERE-like elements in boldface underlined type. The ERE-like
sequences arranged as direct repeats with a 15-bp separation are indicated in the diagram as boxes labelled DR-15. Known or putative
transcription factor binding sites are indicated as circles for Sp1, squares for ERE-like, and triangles for NFY. (B) Schematic diagram and
sequence of the downstream region of the CAV promoter. Numbering is based on the transcription start point (TSP) as +1, indicated by the
right arrow, and corresponds to nt 333 for the 2298-bp CIA-1 genome (GenBank accession no. L14767, Renshaw et al., 1996) or nt 354
for the longer 2319-bp Cux-1 sequence (GenBank accession no. M55918, Noteborn et al., 1991). The TATA box is indicated by the boxed
sequences, and the ATG is circled. Arrows underline GGTCA-like sequences and indicate orientation. Miller et al., Journal of Virology, Vol.
79, No. 5 March. 2005, pp. 2859–2868. Copyright @ 2005, with permission of the American Society for Microbiology.