Page 54 - Avian Virology: Current Research and Future Trends

Newcastle Disease Virus | 47

(A) 498 395/239/179 364 553 577 2204 aa
(55) 1746 (2) 1451 (1) 1241 (1) 1792 (31) 2002 (47) 6703 nt (114) 15,186 nt
3’ Le N P/V/W M F HN L Tr 5’ (total length)

* † ‡
Non-coding region
Genes coding for polymerase complex-
GENOME LENGTH POSITION OF INSERTION INSERTED Nt NDV STRAIN associated proteins
Genes coding for surface glycoproteins
15,192 nt (*)1647 nt +6 nt NDV/goose/China/ZJ1/2000 Gene coding inner membrane protein
15,198 nt (†)2381 nt +12 nt NDV/duck/Germany/DE-R49/99 Intergenic sequence
15,198 nt (*)1647 nt and (‡)8338 nt +6 nt (*) + 6 nt (‡) NDV/chicken/Togo/AKO18/2009

(B) GENE-START GENE-END INTERGENIC SEQUENCE
UGCCCAUCUU N AAUCUUUUUU CA
UGCCCAUCUU P/V/W AAUUCUUUUUU A
UGCCCAUCUU M AAUCUUUUUUU G
UGCCCAUCUU F AAUCUUUUUUU GAUGGCCAACAUCUACUGGUUUCCUGCUAUA
UGCCCAUCUU HN AAUUCUUUUUU ACAUUCACCGUUACUCUAUGUUCCGUUUUGUCGAGUACCAUUUAUUA
UGCCCAUCCU L AAUCUUUUUU

Figure 2.3 The genome of Newcastle disease virus (NDV). (A) Map of the genome of NDV shown 3′–5′ direction. The first row of numbers
above the map indicates the nucleotide lengths of the genes, and the numbers in parentheses indicate the nucleotide lengths of the
non-transcribed leader (Le), trailer (Tr), and intergenic regions. The second row of numbers above the map indicates the amino acid lengths
of the proteins. The position of nucleotide insertion sites is shown below the map. (B) Gene-start, gene-end, and intergenic sequences are
shown in negative sense.

The ‘rule of six’ The NDV genome contains six genes: N, P, M, F, HN and L.
The genomes of the members of the family Paramyxoviridae rep- Each gene encodes one protein except P gene, which encodes
licate efficiently only when their nt length is an even multiple of three proteins (P, V and W) by a mechanism called RNA editing.
six, a requirement called the ‘rule of six’ (Calain and Roux, 1993). The genes are ordered 3′-N-P/V/W-M-F-HN-L-5′ in the genome.
The genomic and antigenomic RNAs of paramyxoviruses are Flanking these genes are extragenic regions called leader and
tightly associated with N protein to form the N-RNA structure. trailer sequences located at the 3′ and 5′ ends of the NDV genome,
The N-RNA protects the RNA from degradation by nucleases. It respectively. The leader and trailer contain the cis-acting regulatory
was found that each N protomer of the Paramyxoviridae is associ- elements involved in transcription, replication and packaging of
ated with exactly six nt. Therefore, a genome whose length is an newly synthesized RNAs into virus particles. The leader and trailer
even multiple of six nt will be precisely encapsidated by the N regions are 55 and 114 nt in length, respectively. The lengths of
protein, with no unprotected nt protruding from the nucleocap- leader and trailer are conserved among all strains of NDV. The leader
sid. Consistent with this, all three natural genome lengths of NDV sequence shows greater than 95% identity among NDV strains. The
are even multiples of six. The ‘rule of six’ does not apply to the first 15 nt of the leader sequence and the last 22 nt of trailer sequence
members of the family Pneumoviridae (Samal and Collins, 1996). are identical for most NDV strains. The first 12 nt of the 3′ and 5′
ends are complementary, indicating that these sequences contain
Genome structure important elements of the genomic and antigenomic promoters.
The structure of NDV genome is similar to that of other mem- One of the properties of Paramyxoviridae is that the genomic
bers of the family Paramyxoviridae (Lamb and Parks, 2013). and antigenomic RNA replication promoters are composed of two
An important feature of the genomic (–) and antigenomic (+) discontinuous regions (Kolakofsky, 2016). In NDV, one promoter
RNAs is that they are never free inside the cell. They are always region (conserved region I) lies within the first 18 nt of the template
tightly associated along their entire length with N proteins to and the other region (conserved region II) lies between nt 73 and 90
form helical nucleocapsids, which are only recognized by the viral of the genomic and antigenomic promoters (Marcos et al., 2005).
RNA-dependent RNA polymerase (RdRp) during both tran- Conserved region I may be involved for interaction with RdRp
scription and replication. The RdRps are composed of a single L and serves as a nucleation site for RNA encapsidation. Conserved
and a tetrameric P. During RNA synthesis, the N–P interaction region II may be required for RNA replication. It was further found
ensures the tethering of L on to the N-RNA template. Therefore, that proper spacing between the two regions and the phase of six of
the P protein is a cofactor that allows the L protein to be recruited conserved region II are critical for promoter activity because both
onto the nucleocapsid template. The nucleocapsid (N-RNA) the regions need to be aligned on the same face of the helix forming a
together with the RdRp (P-L) constitute the ribonucleoprotein single recognition site for binding of the polymerase (Marcos et al.,
(RNP) core, which is the minimum viral replicative unit. 2005).