Page 49 - IBRO_RNA School_Abstract Book
P. 49

IBRO-APRC Associate school of Neuroscience


























               Question 1
               (a)How many exons are there in a gene named "EN2" in the human genome?

               Answer: 2



                                                                                Exon2
                                             Exon1









               (b)Which chromosome does it occur on in the human genome?

               Answer: Chr7, see above fig, orange box
               (c)Does a gene named "EN2" also exist in mouse? (Enable the tracks under "comparative
               genomics" section or "other Refseq" track. It can also be checked by changing the genome
               settings from Human to Mouse)

               Answer: Yes


               Question-2

               (a)The following primers are specific to a gene in mouse. Which gene is it?
               Forward primer – TAGAGGGTGGGCTTTTGTTG

               Reverse primer – GCTCCCTCTGCATCTACGTC
   44   45   46   47   48   49   50   51   52   53   54