Page 50 - IBRO_RNA School_Abstract Book
P. 50

Answer: Malat1











               (b)Is this gene a coding gene or a non-coding gene?
               ☐Coding gene

               ☐Non-coding gene

               It is a non -coding  gene; you can see this from the thickness of the blue line.  Coding
               regions are shown with a thick bar.



               (c)If you use this primer pair for RT-qPCR, what is the expected product size (in basepairs)?

               Answer: 123bp (slight differences may be expected if you are using click and drag to
               zoom in. Some people answered by giving the range of sizes acceptable in a RT-PCR
               reaction. The question was about using the browser to find the exact, expected size from
               the genome.











               Question-3

               The following primers can be used to detect the expression of which gene in mouse?
               Forward primer- CTGATCGTTTGGTGCTGTGT

               Reverse primer- CCCTGAACACCCACTCAGTT

               ☐Specifically Xist

               ☐Specifically Tsix

               ☐Both Tsix and Xist

               ☐Neither Tsix nor Xist



               Ans: Specifically XIST (see below; pay attention to the orientation of forward and reverse
               primers)
   45   46   47   48   49   50   51   52   53   54   55