Page 8 - It's in the DNA_Neat

But what was so bad about Dadaji’s gene? When I was small, I would sometimes
write “SOOOON for “SOON” or repeat some words. Here is a specimen.
I want to be on the the bus.

Like, English, DNA is also made of letters-just four of them. However, all the words
in genes are three letters-long. So Dadaji’s DNA in the ataxia gene should have
looked like this:

ATGGACCAGCAGCAGGCCTCC

But it seems there were some mistakes and it is actually like this.
ATGGACCAGCAGCAGCAGCAGCAGCAGGCCTCC

He still had a good gene copy of the gene but he also had a bad copy with many
repeats of the three letters-CAG. He asked, “ So what is the use of knowing this?”
But I was already thinking about why scientists had put a question mark in my box

and Papa’s box in the pedigree chart.

Was it because we were asking a lot of questions?

Not really! He was wondering whether Papa got the good copy or the bad copy
of Dadaji’s ataxia gene. If Papa got the good copy from Dadaji and another good
copy from Dadiji, he would be fine. Otherwise, I would have to be strong and take
care of both Dadaji and later Papa if he started showing symptoms of ataxia.

Although the mutation in the DNA would be present from birth, the disease symp-
toms strike only when we get older. So Papa still had a few years before he would
find out. The doctor said the scientists could help us find out if Papa got the good

copy or bad copy of the gene, now, long before the disease could strike. He would
run a test on Papa’s DNA, but only if Papa wanted to know. The doctor told us
that many people would prefer not to know. But Papa and Mamma were very sure
that they would like to know as early as possible.

It would help them plan for their future and mine too. The scientist took us to his
lab at the Institute of Genomics and Integrative Biology to test our DNA. Since I
was a kid my DNA would not be tested. But Papa, Dadaji and Mamma could give

a saliva sample from which the scientist made their DNA. I know that was not a
big deal. Saliva contains our cells, so like all other cells of our body it also had the
same DNA!