Page 101 - Avian Virology: Current Research and Future Trends

Figure 4
94 | Paldurai and Samal

APMV strain 3’-Leader sequence

APMV-1 (LaSota) UGGUUUGUCUCUUAGGCACUCAAUGCUAUUUUCCGCUUUCUCGUUAACUUCAGUG
APMV-2 (Yucaipa) ........UC....UC..U..GU...AU..AGAAU..A.U.U.G..U...AG.CA
APMV-3 (Netherlands) ..A.......U...AUU.UGA.CAAUC..CAG.G...AAU.A.GCG.U.AU.UAA
APMV-4 (Hong Kong) ..C...U...UC.UAUUUUC.GUCUUCGGAAAAUUU.CCU.G.GACC.GA...CA
APMV-5 (Kunitachi) ........UC....C..GU..GU..AAU..AAAAUU.A..G.AC..U.ACU.UA.
APMV-6 (Hong Kong) ........UC...U..U.UA.G.AC.CC.GAAAU...C..G..AAC.U..UG.CA
APMV-7 (Tennessee) ........UC..G.C.U.U..GUCA.AU...GAAAA..AU.UU...UUGAA..CA
APMV-8 (Delaware) ........UC....C.UU..GGU...CC..GAAAUU.A.U.U....G...A.UAA
APMV-9 (New York) ........U....UAA..U..U....A....CUG....CA.....G...GA..CA
APMV-10 (Falkland Islands/324) ........UC..G.UCU.U.GGG...AC.GGCAAUUGAC..UU.AUU..A..ACA
APMV-11 (France/100212) .......GUC..AGU.UGAC.GC...AC.C.A.AU....U.UAA..G.....UCA
APMV-12 (Italy/3920-1) ...AA.....UAG..A..AA.C....A..A..U.U..ACU.UA.AU....A.ACA
APMV-13 (Shimane/67) ............A..A..U..C...GA.....AU....AA.UA.......G.UC.
APMV-14 (11OG0352) ........UC....A.UCU..CCAUGAC..AAAUU...CUGU.AC.GAG.A..CA
APMV-16 (UPO216) ...............A..U..C....C...C..U....GU..........U....
APMV-20 (Kazakhstan/5976) ...C....UC....UC.UU..GU...AC.A.A.AU....U.UU.GCGGG.AGUCA
APMV-21 a (Cheonsu/1510) ........U....UAA..UA.C....G..A.CUU...GCA.....G..AAAC.CA

Figure 3.4 Sequence alignment of 55-nucleotide leader region of avian paramyxovirus serotypes. The genome-sense RNA sequence of
the prototype strains of the available complete 3’leader regions were compared. The dots indicate the amino acid identity of that position
a
in comparison to the 3’leader sequence of avian paramyxovirus 1 strain LaSota. Putative APMV serotype awaiting official recognition from
the ICTV.

Figure 5

F cleavage Gene-start Gene-end
APMV strain
site sequence sequence sequence
APMV-1 (LaSota) G-R-Q-G-R↓L UGCCCAUCUU AAUCUUUUUU
(Beaudette C) R-R-Q-K-R↓F .......... ..........
APMV-2 (Yucaipa) K-P-A-S-R↓F CC...GCUG. ...UC.....U
(Bangor) L-P-S-A-R↓F CC...GCUG. ...UC.....U
APMV-3 (Netherlands) R-P-R-G-R↓L .C.U.GC... ...UA.....U
(Wisconsin) R-P-S-G-R↓L .C.U.GC... ...UA.....U
APMV-4 (Hong Kong) D-I-Q-P-R↓F .C.A..C.C. ...UAA....U
APMV-5 (Kunitachi) R-R-K-K-R↓F CU...UCU.A ...A......
APMV-6 (Hong Kong) A-P-E-P-R↓L CU...CCU.C ...UC.....U
(Italy) I-R-E-P-R↓L CU...CCU.C ...UC.....U
APMV-7 (Tennessee) L-P-S-S-R↓F CU....CU.A ...UA.....U
APMV-8 (Delaware) Y-P-Q-T-R↓L CC...GCU.C ...UC.....U
APMV-9 (New York) I-R-E-G-R↓I .......... ...G......
APMV-10 (Falkland Islands/324) K-P-S-Q-R↓I .C...GCUGG ...UC.....U
APMV-11 (France/100212) S-G-T-K-R↓F C....GCU.C ...UA.....U
APMV-12 (Italy/3920-1) G-R-E-P-R↓L .....G.... ...UC.....UU
APMV-13 (Shimane/67) V-R-E-N-R↓L .....G.... ...UC.....U
APMV-14 (11OG0352) T-R-E-G-K↓L CU...CCU.A ...UA.....U
APMV-15 (RS-1177) V-P-K-E-R↓L CC...GCUGG ...UC.....U
APMV-16 (UPO216) L-V-Q-A-R↓L .......... ..........
APMV-17 (APV-A) G-I-Q-S-R↓I .....G.... ...UA.....U
b
APMV-18 (APV-B ) A-A-Q-S-R↓L .....G.... ...UC.....U
APMV-19 (APV-C) R-G-Q-A-R↓I .....G.... ...UC.....U
APMV-20 (Kazakhstan/5976) E-Q-Q-A-R↓L CC...GCUGG ...UC.....U
APMV-21 a (Cheonsu/1510) D-R-E-G-R↓L .......... ..........
Figure 3.5 Sequence alignment of fusion protein cleavage site sequences, genome-sense gene-start and gene-end sequences of avian
paramyxovirus serotypes. The downwards arrow indicates the site of fusion protein cleavage. The basic residues in the fusion protein
a
cleavage site are given in bold. Putative APMV serotype awaiting official recognition from the ICTV. The gene-start (GS) and gene-end
b
(GE) sequences are taken from the nucleocapsid (N) gene except for APMV-18 strain APV-B , where GS of the N gene is not determined,
the GS and GE sequences were taken from its phosphoprotein gene. The dots indicate the nucleotide identity in that position. Entire
continuous-stretch of poly(U) sequence was included as part of the GE.